View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11915_low_33 (Length: 290)

Name: NF11915_low_33
Description: NF11915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11915_low_33
NF11915_low_33
[»] chr5 (2 HSPs)
chr5 (164-271)||(5996920-5997027)
chr5 (40-106)||(5996850-5996918)


Alignment Details
Target: chr5 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 164 - 271
Target Start/End: Original strand, 5996920 - 5997027
Alignment:
164 aacattacatcaaacttaaaactttacggtatgacatcaaatatctatcgacaattttggcacttacagttcgaatgaactcaaagatagagcgtattat 263  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |||||||||||    
5996920 aacattacatcaaacttaaaactttacggtatgacatcaaatatctaccgacaattttggcacttacaattcgaatgaactcaaagattgagcgtattat 5997019  T
264 cttcaacc 271  Q
    ||||||||    
5997020 cttcaacc 5997027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 40 - 106
Target Start/End: Original strand, 5996850 - 5996918
Alignment:
40 taatttaaatgcaca--gatgacataaaactgcatgtctagatatctctaagtcaaaaccaccgtttaa 106  Q
    |||||||||||||||  ||||||||||||||||||||||||||||||||||||||||| ||||||||||    
5996850 taatttaaatgcacaacgatgacataaaactgcatgtctagatatctctaagtcaaaaacaccgtttaa 5996918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University