View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11915_low_34 (Length: 280)
Name: NF11915_low_34
Description: NF11915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11915_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 115 - 265
Target Start/End: Original strand, 41103802 - 41103954
Alignment:
| Q |
115 |
tggtatttaaaaacaagttatc----taccatttgcttgtcttatactcatgtgaaaccaccacttgcatgtcttattctcgtagagtcagtcatatgca |
210 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
41103802 |
tggtatttaaaaacaagttatccaactaccatttgcttgtcttatactcatgtgaaaccaccacttgcatctcttattctcgtag----agtcatatgca |
41103897 |
T |
|
| Q |
211 |
t--ggtatttaaaaagttacgtaagtaccatgaaaatgggcgtgtctacaattttgt |
265 |
Q |
| |
|
| ||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41103898 |
tggggtatttaaaatgttacgtaagtaccatgaaaatggacgtgtctacaattttgt |
41103954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 14 - 79
Target Start/End: Original strand, 41103737 - 41103802
Alignment:
| Q |
14 |
aaaagaaaaaattacacaatatctaactaccatttgcatgtcttattctcacataagccatattat |
79 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
41103737 |
aaaagaaacaattacacaatatctaactaccatttgcatgtcttattctcacagaagtcatattat |
41103802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University