View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11915_low_35 (Length: 270)
Name: NF11915_low_35
Description: NF11915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11915_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 252
Target Start/End: Complemental strand, 17898523 - 17898288
Alignment:
| Q |
17 |
aatatgaaacaagatattttgtcccttttatgaggggattcagcaatgggattttcttaatatttttagagattgtgccactatgtgtgggtcttaaaga |
116 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17898523 |
aatatgaaacaggatattttgtcccttttatgaggcgattcagcaatgggattttcttaatatttttagagattgtgccactatgtgtgggtcttaaaga |
17898424 |
T |
 |
| Q |
117 |
taactttccaaatgacaannnnnnnnaaaagggcactgaaaagttttccattattatttttcttcttgcgttgcagctagatttccattcatcatctaat |
216 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17898423 |
taactttccaaatgacaattttttttaaaagggcactgaaaagttttccattattatttttcttcttgcgttgcagctagatttccattcatcatctaat |
17898324 |
T |
 |
| Q |
217 |
ttgttttatattttaacgtcaaaatattcctaatct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
17898323 |
ttgttttatattttaacgtcaaaatattcctaatct |
17898288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University