View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11915_low_43 (Length: 239)
Name: NF11915_low_43
Description: NF11915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11915_low_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 37498685 - 37498475
Alignment:
| Q |
18 |
acaacaaggtgttttgaagataacagcctgatatctccaggaaagaggtcgccaggttcaaaaatcacaatatcacctggaactacatccatgtgatcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37498685 |
acaacaaggtgttttgaagataacagcctgatatctccaggaaagaggtcgccaggttcaaaaatcacaatatcacctggaactacatccatgtgatcaa |
37498586 |
T |
|
| Q |
118 |
cttgaactatcaattctttctgttcaattctaccagcacatctttgaacttttataggacaccttaaaaattctgaaagtttcattgcggcttttgagct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37498585 |
cttgaactatcaattctttctgttcaattctaccagcacatctttgaacttttataggacaccttaaaaattctgaaagtttcatcgcggcttttgagct |
37498486 |
T |
|
| Q |
218 |
tctgtgctcct |
228 |
Q |
| |
|
|||||| |||| |
|
|
| T |
37498485 |
tctgtgttcct |
37498475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University