View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11915_low_46 (Length: 208)
Name: NF11915_low_46
Description: NF11915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11915_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 22 - 167
Target Start/End: Original strand, 39776418 - 39776563
Alignment:
| Q |
22 |
agaacaatcaactccagattattaacatgaacattttgaatatgaaagcatacaaagaaagcgtgcgtacagaaccattcattggtcataacaaataaga |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39776418 |
agaacaatcaactccagattattaacatgaacattttgaatatgaaagcatacaaagaaagcgtgcgtacagaaccattcattggtcataacaaatatga |
39776517 |
T |
 |
| Q |
122 |
taaataaaatagctgtaaattacacatatcaggaaattacatttag |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39776518 |
taaataaaatagctgtaaattacacatatcaggaaattacatttag |
39776563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University