View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11916_high_28 (Length: 250)

Name: NF11916_high_28
Description: NF11916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11916_high_28
NF11916_high_28
[»] chr3 (3 HSPs)
chr3 (143-240)||(31296285-31296390)
chr3 (1-74)||(31296459-31296532)
chr3 (143-209)||(31294610-31294673)


Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 143 - 240
Target Start/End: Complemental strand, 31296390 - 31296285
Alignment:
143 ccatgttgctatgtttttctatgggaaaacaaagaacaatgatgaatctattttccctctttttct--------ctctgtgttttgtgagttgaatggat 234  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||| |||||||||||||||||||||    
31296390 ccatgttgctatgtttttctatgggaaaacaaagaacaatgatgaatctattttccctctttttctctctctctctctatgttttgtgagttgaatggat 31296291  T
235 cctatg 240  Q
    ||||||    
31296290 cctatg 31296285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 31296532 - 31296459
Alignment:
1 ccacctccgtttttgtcggggaaaagctttgcatcgccgtagagatcagtgtcagggtcgaaatttgggatatt 74  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31296532 ccacctccggttttgtcggggaaaagctttgcatcgccgtagagatcagtgtcagggtcgaaatttgggatatt 31296459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 209
Target Start/End: Complemental strand, 31294673 - 31294610
Alignment:
143 ccatgttgctatgtttttctatgggaaaacaaagaacaatgatgaatctattttccctctttttctc 209  Q
    ||||||||||||||||  | | |||||||||| | ||||||||||||||||||||||||||||||||    
31294673 ccatgttgctatgttt--caaagggaaaacaa-gtacaatgatgaatctattttccctctttttctc 31294610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University