View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11916_high_33 (Length: 238)
Name: NF11916_high_33
Description: NF11916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11916_high_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 5 - 224
Target Start/End: Original strand, 31296693 - 31296912
Alignment:
| Q |
5 |
gatcttgccgctgctttccccggtaatggctcctatggtcttggcttctctcctcctactccgacgaacagctacctcggcgtcgaattcgatacctcga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31296693 |
gatcttgccgctgctttccccggtaatggctcctatggtcttggcttctctcctcctactccgacgaacagctacctcggcgtcgaattcgatacctcga |
31296792 |
T |
|
| Q |
105 |
aggatgataatgttggtgatctgaatgctaatcatgttggtattaatctaggaagtcttgtatctgttgctgttgcaaatgtttctaaatcgaatttggt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31296793 |
aggatgataatgttggtgatctgaatgctaatcatgttggtattaatctaggaagtcttgtatctgttgctgttgcaaatgtttctaaatcgaatttggt |
31296892 |
T |
|
| Q |
205 |
tttgaatagtggtgaaaagt |
224 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
31296893 |
tttgaatagtggtgaaaagt |
31296912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University