View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11916_low_23 (Length: 306)
Name: NF11916_low_23
Description: NF11916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11916_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 71 - 300
Target Start/End: Original strand, 45109027 - 45109256
Alignment:
| Q |
71 |
ttgttgaccttatcatccctaattttcatgtcattcatctcctcaggcaacttttcaacagcaactgaacttgcattcttatctataaatccagaagcag |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45109027 |
ttgttgaccttatcatccctaattttcatgtcattcatctcctcaggcaacttttcaacagcaactgaacttgcattcttatctataaatccagaagcag |
45109126 |
T |
 |
| Q |
171 |
gtgcaacaccacctgatgccatcatctcttnnnnnnngtacaaaacactttacttaattatttccttacagatcatgcaaggcttcaaaactgaacctcc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45109127 |
gtgcaacaccacctgatgccatcatctcttaaaaaaagtacaaaacactttacttaattatttcctttcagatcatgcaaggcttcaaaactgaacctcc |
45109226 |
T |
 |
| Q |
271 |
aacaccaaaatcaactcttcaagttcaacc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45109227 |
aacaccaaaatcaactcttcaagttcaacc |
45109256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 77 - 196
Target Start/End: Complemental strand, 38649867 - 38649745
Alignment:
| Q |
77 |
accttatcatccctaattttcatgtcattcatctcctcaggcaacttttcaacagcaa---ctgaacttgcattcttatctataaatccagaagcaggtg |
173 |
Q |
| |
|
|||||||||||| ||||| ||||| || ||||| ||||| ||||| |||||||||| ||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
38649867 |
accttatcatccttaattctcatgccaagaatctcatcaggtaacttatcaacagcaatagctgaacttgcatttacatctactaatccagaagcaggtg |
38649768 |
T |
 |
| Q |
174 |
caacaccacctgatgccatcatc |
196 |
Q |
| |
|
| ||||| ||| |||||||||| |
|
|
| T |
38649767 |
ctacacccgctgttgccatcatc |
38649745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University