View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11916_low_27 (Length: 257)
Name: NF11916_low_27
Description: NF11916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11916_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 25 - 239
Target Start/End: Complemental strand, 25342875 - 25342661
Alignment:
| Q |
25 |
cttgcatatattatacattaatgtctatatcaactgaaataagatcacggggactcttatcacttggattaatccaataacagtgtttttaagtattttc |
124 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| |||| ||| | |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25342875 |
cttgcatatattatgcattaatgtccatatcaactgagctaagctcaggtggactcttatcacttggattaatccattaacagtgtttttaagtattttc |
25342776 |
T |
|
| Q |
125 |
taaaatgtgatagaagtacatatatgactccacttttctgaaacgattttggttatggaagtccctttctttagtccgtataattgtcggctaagaaact |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||| |||| |||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
25342775 |
taaaatgtgatagaagtacatatatgactccacctttctaaaatgattctggttatggaagtccctttctttagtccgtattactgtcggctaagaaact |
25342676 |
T |
|
| Q |
225 |
acacacactaaaaac |
239 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
25342675 |
acacacactaaaaac |
25342661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 78
Target Start/End: Original strand, 16580811 - 16580866
Alignment:
| Q |
20 |
cagaccttgcatatattatacattaatgtctatatcaactgaaataagatcacggggac |
78 |
Q |
| |
|
||||||||||||||||||||||| |||| ||| |||||||| |||| |||||||||| |
|
|
| T |
16580811 |
cagaccttgcatatattatacat---tgtccataccaactgaattaagctcacggggac |
16580866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University