View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11916_low_29 (Length: 250)
Name: NF11916_low_29
Description: NF11916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11916_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 143 - 240
Target Start/End: Complemental strand, 31296390 - 31296285
Alignment:
| Q |
143 |
ccatgttgctatgtttttctatgggaaaacaaagaacaatgatgaatctattttccctctttttct--------ctctgtgttttgtgagttgaatggat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
31296390 |
ccatgttgctatgtttttctatgggaaaacaaagaacaatgatgaatctattttccctctttttctctctctctctctatgttttgtgagttgaatggat |
31296291 |
T |
 |
| Q |
235 |
cctatg |
240 |
Q |
| |
|
|||||| |
|
|
| T |
31296290 |
cctatg |
31296285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 31296532 - 31296459
Alignment:
| Q |
1 |
ccacctccgtttttgtcggggaaaagctttgcatcgccgtagagatcagtgtcagggtcgaaatttgggatatt |
74 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31296532 |
ccacctccggttttgtcggggaaaagctttgcatcgccgtagagatcagtgtcagggtcgaaatttgggatatt |
31296459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 209
Target Start/End: Complemental strand, 31294673 - 31294610
Alignment:
| Q |
143 |
ccatgttgctatgtttttctatgggaaaacaaagaacaatgatgaatctattttccctctttttctc |
209 |
Q |
| |
|
|||||||||||||||| | | |||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
31294673 |
ccatgttgctatgttt--caaagggaaaacaa-gtacaatgatgaatctattttccctctttttctc |
31294610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University