View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11916_low_31 (Length: 243)
Name: NF11916_low_31
Description: NF11916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11916_low_31 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 4 - 237
Target Start/End: Complemental strand, 13147378 - 13147144
Alignment:
| Q |
4 |
tttaacaacataagattggtctcaatgaatattttgtttttgacaggatttatcatccttataaattgatgtacttt-cttgaaaaggaattgcttcatc |
102 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
13147378 |
tttaacaacataagattggtctcaatcaatattatgtttttgacaggatttatcatccttataaatttatgtacttttcttgaaaaggaattgcttcatc |
13147279 |
T |
|
| Q |
103 |
aacatcaacattttcctgctacatttcccataaggatcttaataatcccatggccatattaggctctactttgacttgttgagattcaataatatcagta |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
13147278 |
aacatcaacattttcctgctacatttcccataaggatcttaataatcccatggccatattaggctctactttgacttgtcgagattcattaatatcagta |
13147179 |
T |
|
| Q |
203 |
ccttctgtcttcccaaaaatatactgatgtccatc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
13147178 |
ccttctgtcttcccaaaaatatactgatatccatc |
13147144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University