View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11917_high_10 (Length: 286)
Name: NF11917_high_10
Description: NF11917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11917_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 9e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 37110536 - 37110446
Alignment:
| Q |
1 |
gctttagtgatgaagggtttggaccaattccatcaaagtggagaggaatatgtgataaggggagtgatcctagttttcactgcaacaggta |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37110536 |
gctttagtgatgaagggtttggaccaattccatcaaagtggagaggaatatgtgataaggggagggatcctagttttcactgcaacaggta |
37110446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University