View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11917_low_12 (Length: 254)
Name: NF11917_low_12
Description: NF11917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11917_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 3892610 - 3892846
Alignment:
| Q |
1 |
tattaataatattttttctaaattcatgttgattgatttctttgtttgtttttgttgttataatcacaaattgaaattaatgggatttttatgtttaact |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3892610 |
tattaataatatttt-tctaaattcatgttgattgatttctttgtttggtcttgttgttataatcacaaattgaaattaatgggatttttatgtttaact |
3892708 |
T |
 |
| Q |
101 |
tgtctgtttaatgaaacaggacttagtttaatttgtgattaattatgatggatgcaatggagaaaaattcaagagatgttgagagtgatgaaaaatttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3892709 |
tgtctgtttaatgaaacaggacttagtttaatttgtgattaattatgatggatgcaatggagaaaaattcaagagatgttgagagtgatgaaaaatttga |
3892808 |
T |
 |
| Q |
201 |
attgccacctggatttaggtttcatccaacagatgaag |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3892809 |
attgccacctggatttaggtttcatccaacagatgaag |
3892846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University