View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11919_high_3 (Length: 363)
Name: NF11919_high_3
Description: NF11919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11919_high_3 |
 |  |
|
| [»] scaffold0361 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 32 - 351
Target Start/End: Original strand, 30010151 - 30010470
Alignment:
| Q |
32 |
aattattaagtatgtttgagagttttcgattagaattgattttgactatagaaattgattatataggattagtagattttattgctcaaatttattattc |
131 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30010151 |
aattattaagtatgttcgagagttttcgattagaattgattttgactatagaaattgattatataggattagtagattttattgctcaaatttattattc |
30010250 |
T |
 |
| Q |
132 |
aactcagtttcatgtgaatcaatccaaacataaatcattataccctgaattgattttaactaaaaatgaattttaaaaatttaattcagtcataatcaat |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30010251 |
aactcagtttcatgtgaatcaatccaaacataaatcattataccctaaattgattttaactaaaaatgaattttaaaaatttaattcagtcataatcaat |
30010350 |
T |
 |
| Q |
232 |
tttcgccgcttagaaccatatataccactacatctaatctgtaataaatttgacnnnnnnnnnnnnnnnnnngcttctaaatttcaggtgtttggggtgt |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30010351 |
tttcgccgcttagaaccatatataccactacatctaatctgtaataaatttgactttttttggaatttttttgcttctaaatttcaggtgtttggggtgt |
30010450 |
T |
 |
| Q |
332 |
tacatttgattgtgtctctg |
351 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30010451 |
tacatttgattgtgtctctg |
30010470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0361 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0361
Description:
Target: scaffold0361; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 116 - 168
Target Start/End: Complemental strand, 14143 - 14091
Alignment:
| Q |
116 |
ctcaaatttattattcaactcagtttcatgtgaatcaatccaaacataaatca |
168 |
Q |
| |
|
|||||||||||| ||||||||| ||||| ||||| |||||||||||||||| |
|
|
| T |
14143 |
ctcaaatttatttttcaactcactttcacatgaatgtatccaaacataaatca |
14091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 114 - 170
Target Start/End: Original strand, 28228905 - 28228961
Alignment:
| Q |
114 |
tgctcaaatttattattcaactcagtttcatgtgaatcaatccaaacataaatcatt |
170 |
Q |
| |
|
|||||||||||||| || |||| | ||||||||||| | ||||| |||||||||||| |
|
|
| T |
28228905 |
tgctcaaatttattgtttaactaactttcatgtgaaactatccacacataaatcatt |
28228961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University