View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11919_low_8 (Length: 260)
Name: NF11919_low_8
Description: NF11919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11919_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 34 - 136
Target Start/End: Original strand, 47679468 - 47679570
Alignment:
| Q |
34 |
ataacaaacgaccatgtaaaatacaaagaagtgaaaggttttttggtctgacctgtaggattgactttaaaaagaaatcagttagaccttgttttaatgt |
133 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47679468 |
ataacaaacgagcatgtgaaatacaaagaagtgaaaggttttttggtctgacctgtaggattgactttaaaaagaaatcagttagaccttgttttaatgt |
47679567 |
T |
 |
| Q |
134 |
gct |
136 |
Q |
| |
|
||| |
|
|
| T |
47679568 |
gct |
47679570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 171 - 246
Target Start/End: Original strand, 47679570 - 47679645
Alignment:
| Q |
171 |
ttagttgcccttggtatagcatgagttggattgtgataggtattgatagcattaagatgtttacttattatctgtg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47679570 |
ttagttgcccttggtatagcatgagttggattgtgataggtattgatagcattaaggtgtttacttattatctgtg |
47679645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University