View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11920_low_5 (Length: 313)

Name: NF11920_low_5
Description: NF11920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11920_low_5
NF11920_low_5
[»] chr7 (1 HSPs)
chr7 (233-298)||(35480349-35480414)


Alignment Details
Target: chr7 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 233 - 298
Target Start/End: Original strand, 35480349 - 35480414
Alignment:
233 ttgcattcgcgaagccttcgtggataaatctttcgctttatatagcaatcctcttttgacacaaag 298  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
35480349 ttgcattcgcgaagccttcatggataaatctttcgctttatatagcaatcctcttttgacacaaag 35480414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University