View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11921_high_21 (Length: 308)
Name: NF11921_high_21
Description: NF11921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11921_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 104 - 292
Target Start/End: Original strand, 3810982 - 3811170
Alignment:
| Q |
104 |
gaatgtggaacataacaggtacccttaaaaagaaaataaagacaataaattaaacgattaaccacaaattcattactcttaaaagggtttgttatcggtt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810982 |
gaatgtggaacataacaggtacccttaaaaagaaaataaaaacaataaattaaacgattaaccacaaattcattactcttaaaagggtttgttatcggtt |
3811081 |
T |
 |
| Q |
204 |
gaagttatcaatatccatgaaaattacattaatgagctatattccattgaaacacatcttcagcacatgcataacctcacgcttcacag |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3811082 |
gaagttatcaatatccatgaaaattacattaatgagctatattccattgaaacacatcttcagcacatgcataacctcacgcttcacag |
3811170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University