View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11921_high_22 (Length: 277)
Name: NF11921_high_22
Description: NF11921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11921_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 17 - 179
Target Start/End: Complemental strand, 43526931 - 43526769
Alignment:
| Q |
17 |
aaatagatagatagacatgacattacttacttgcgcttccactgtggtttgatcctgtttatgtcaattttgggttctccaatggaggaggaggcagaag |
116 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43526931 |
aaatagatagatagatatgacattacttacttgcgcttccactgtggtttgatcctgtttatgtcaattttgggttctccaatggaggaggaggcagaag |
43526832 |
T |
 |
| Q |
117 |
gaacaaatggatatgattcttcaacgtcgtccttcgctgctgcctccacatcaatatccttct |
179 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43526831 |
ggacaaatggatatgattcttcaacgtcgtccttcgctgctgcctccacatcaatatctttct |
43526769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University