View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11921_high_26 (Length: 246)
Name: NF11921_high_26
Description: NF11921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11921_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 36158110 - 36157880
Alignment:
| Q |
1 |
catttccatatactcttcagtactacagaacaatacagttgtctgatcatttttgggtatatgaggatgtttgtagtagcagcaagtcttgagctcgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36158110 |
catttccatatactcttcagtactacagaacaatacagttgtctgatcatttttgggtatatgaggatgtttgtagtagcagcaagtcttgagctcgaat |
36158011 |
T |
 |
| Q |
101 |
atttatcttcgtatttatgtg-annnnnnnnattgtttttctttatatgagatgatgtttgcattaatttggaaggctctactgataaacatcacaagtg |
199 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36158010 |
atttatcttcgtatttatgtgaattttttttattgtttttctttatatgagatgatgtttgcattaatttggaaggctctaccgataaacatcacaagtg |
36157911 |
T |
 |
| Q |
200 |
cctactatgctaaaatcatagaagaattata |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36157910 |
cctactatgctaaaatcatagaagaattata |
36157880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 139 - 226
Target Start/End: Complemental strand, 36153033 - 36152947
Alignment:
| Q |
139 |
tctttatatgagatgatgtttgcattaatttggaaggctctactgataaacatcacaagtgcctactatgctaaaatcatagaagaat |
226 |
Q |
| |
|
||||||||| | |||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||||||||||| ||||| |
|
|
| T |
36153033 |
tctttatataatatgatgtttgcattgatttggaaggctctactgataaa-attacaagtgcctactatgctaaaatcataggagaat |
36152947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University