View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11921_high_27 (Length: 239)
Name: NF11921_high_27
Description: NF11921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11921_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 41 - 224
Target Start/End: Complemental strand, 36695123 - 36694940
Alignment:
| Q |
41 |
ataaatatctcaatcattggattaatccaacgggaatggatgagaatagtgcagcagagggggctgtagacaaaattgttgaggattcagacctctataa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36695123 |
ataaatatctcaatcattggattaatccaacgggaacggatgagaatagtgcagcagagggggctgtagacaaaattgttgaggattcagacctctataa |
36695024 |
T |
 |
| Q |
141 |
tcccagtgtcaagaaaattatgataatgctttcgtcaccccttccacaatcaaactaaacatttgaataatctaatttgttact |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36695023 |
tcccagtgtcaagaaaattatgataatgctttcgtcatcccttccacaatcaaactaaacatttgaataatctaatttgttact |
36694940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 41 - 201
Target Start/End: Complemental strand, 36675447 - 36675290
Alignment:
| Q |
41 |
ataaatatctcaatcattggattaatccaacgggaatggatgagaatagtgcagcagagggggctgtagacaaaattg---ttgaggattcagacctcta |
137 |
Q |
| |
|
||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||| |||||||||||||| |||||||||||||||| | |
|
|
| T |
36675447 |
ataaatatctcgatcattggattaatccaacag------atgagaatagtgcagcagagggggttgtagacaaaattgctgttgaggattcagacctatc |
36675354 |
T |
 |
| Q |
138 |
taatcccagtgtcaagaaaattatgataatgctttcgtcaccccttccacaatcaaactaaaca |
201 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
36675353 |
taatcccagcgtcaagaaaattatgataatgttttcctcaccccttccacaatcaaactaaaca |
36675290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University