View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11921_low_26 (Length: 272)
Name: NF11921_low_26
Description: NF11921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11921_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 19 - 259
Target Start/End: Complemental strand, 18028746 - 18028506
Alignment:
| Q |
19 |
ctcaaggtcggtttgttcacttagcagcttcagttattgcatcttttgggtttgtcactctccattgtagcggattctctcaggtgcgatataggtgggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18028746 |
ctcaaggtcggtttgttcacttagcagcttcagttattgcatcttttgggtttgtcactctccattgtagcggattctctgaggtgcgatataggtgggt |
18028647 |
T |
 |
| Q |
119 |
tctttgttttactggtttgtggtttctatcgagtttatcttcgcaaggactagacgaagagctcttgttttctggtagagtttctccattgtggttcatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18028646 |
tctttgttttactggtttgtggtttctatcgagtttatcttcgcaaggactagacgaagagctcttgttttctggtagagtttctccattgtggttcatt |
18028547 |
T |
 |
| Q |
219 |
gctggtttttggttttctgttcggccccttgctccagatct |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18028546 |
gctggtttttggttttctgttcggccccttgctccagatct |
18028506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University