View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11921_low_32 (Length: 233)
Name: NF11921_low_32
Description: NF11921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11921_low_32 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 10 - 211
Target Start/End: Original strand, 13161981 - 13162190
Alignment:
| Q |
10 |
atgagttagagaaatcatttagcgagaaagacgtaaagtaattaagcagttttggattgtgat---------aggcccgggccatatgggattaactatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| || ||| | || ||||| |||||| | |
|
|
| T |
13161981 |
atgagttagagaaatcatttagcgagaaagatgtaaagtaattaagcagttttgaattgtgatcgttttaagagtcccagaacacatggggttaactttt |
13162080 |
T |
|
| Q |
101 |
gttttataaaggatttatggattgacatcaaaggtaattttatgaaatttttgctggaattttacttgtctggtaggctagtgaaaggatctaattgttt |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
13162081 |
gttttataa-ggatttatggattgacatcaaaggtaattttatgaaatttttgctggaattttacttgtatggtaggctggtgaaaggatctaattgttt |
13162179 |
T |
|
| Q |
201 |
atttatttatt |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
13162180 |
atttatttatt |
13162190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 194 - 233
Target Start/End: Complemental strand, 3810962 - 3810923
Alignment:
| Q |
194 |
attgtttatttatttattgtttattttgaatgtttgagtt |
233 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
3810962 |
attgtttaattatttgttgtttattttgaatgtttgagtt |
3810923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University