View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11921_low_34 (Length: 226)
Name: NF11921_low_34
Description: NF11921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11921_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 30 - 212
Target Start/End: Complemental strand, 22915743 - 22915560
Alignment:
| Q |
30 |
atttaaaatcaatttt-gtcgctacaaaaacaaatactcactacatctttgtaaattaaatttgaaaatcaaaagaagaaatgaaccaagggtgaacctt |
128 |
Q |
| |
|
|||||||||||||||| || ||| | ||||||||||| |||||||||||| | |||| ||||||| ||||||||| |||||||| ||||||||||||| |
|
|
| T |
22915743 |
atttaaaatcaatttttgtagctttagaaacaaatacttactacatctttgctacttaattttgaaattcaaaagaaaaaatgaactaagggtgaacctt |
22915644 |
T |
|
| Q |
129 |
atttaaccagcctaactctatattgtttaggcaaatatagccaagcaaaaccacacaaacgagggatccaactttattcatctc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
22915643 |
atttaaccagcctaactctatattgtttaggcaaatatagccaagcaaaaccacacaaaagagggatccaactttattcgtctc |
22915560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University