View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11921_low_36 (Length: 222)
Name: NF11921_low_36
Description: NF11921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11921_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 207
Target Start/End: Original strand, 36263687 - 36263879
Alignment:
| Q |
15 |
gatgaaccctgatagaactctaggaccagcttttgtacacaatgagtatagaggaatatggatatatttgctgtcgccgattttgggggccatcgccgga |
114 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36263687 |
gatgaaccctgttagaactctaggaccagcttttgtacacaatgagtatagaggaatatggatatatttgctgtcgccgattttgggggccatcgccgga |
36263786 |
T |
 |
| Q |
115 |
gcatgggtctacaacactgttaggtacactaacaagccattgcgtgagatcacccagagtgcatccttcctcagagaagctgggcgtggtgga |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36263787 |
gcatgggtctacaacactgttaggtacactaacaagccattgcgtgagatcacccagagtgcatccttcctcaaagaagctgggcgtggtgga |
36263879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 81
Target Start/End: Original strand, 5398503 - 5398549
Alignment:
| Q |
35 |
taggaccagcttttgtacacaatgagtatagaggaatatggatatat |
81 |
Q |
| |
|
||||||||||| |||| ||| |||| ||||||||||||||||||||| |
|
|
| T |
5398503 |
taggaccagctattgtgcaccatgaatatagaggaatatggatatat |
5398549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 81
Target Start/End: Complemental strand, 5406621 - 5406575
Alignment:
| Q |
35 |
taggaccagcttttgtacacaatgagtatagaggaatatggatatat |
81 |
Q |
| |
|
||||||||||| |||| ||| |||| ||||||||||||||||||||| |
|
|
| T |
5406621 |
taggaccagctattgtgcaccatgaatatagaggaatatggatatat |
5406575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University