View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11922_high_14 (Length: 266)
Name: NF11922_high_14
Description: NF11922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11922_high_14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 20 - 266
Target Start/End: Complemental strand, 52239508 - 52239261
Alignment:
| Q |
20 |
ttgggctgaatactt-atgattaatttatgtgatggaacaacttgattttgttagcagcaattcctgacatttcatttgctgatattgaagataaagagg |
118 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52239508 |
ttgggctgaatacttgatgattaaattatgtgatggaacaacttgattttgttagcagcaattcctgacatttcatttgctgatattgaagataaagagg |
52239409 |
T |
|
| Q |
119 |
agtccttccatgataatttcacggtattccattgttaaattaaatatgttccgagtgttgaaatttttaccttcacgtgcttatgtggataagctcctga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52239408 |
agtccttccatgataatttcacggtattccattgttaaattaaatatgttccgagtgttgaaatttttaccttcacgtgcttatgtggataagctcctga |
52239309 |
T |
|
| Q |
219 |
tttggaatttgcagatcgaagtattatcccaagatgagggtgatgtct |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52239308 |
tttggaatttgcagatcgaagtattatcccaagatgagggtgacgtct |
52239261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University