View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11922_low_15 (Length: 252)
Name: NF11922_low_15
Description: NF11922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11922_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 421282 - 421379
Alignment:
| Q |
1 |
ctcatttcatttgattcagagaaaacagtgtgtaatgtaatggcgtgtacattaagtctattatcacacacactctctctctcactatcactataactat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
421282 |
ctcatttcatttgattcagagaaaacagtgtgtaatgtaatggcgtgtacattaagtctattatcacacaca--ctctctctcactataactataactat |
421379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 161 - 248
Target Start/End: Original strand, 421436 - 421523
Alignment:
| Q |
161 |
gctatgctaaatgggttgtgcgcttaaaagatctcactttcaccctaaaaaagctgaacacttttgtctccatctcttcatctctctc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
421436 |
gctatgctaaatgggttgtgcgcttaaaagatctcactttcaccctaaaaaagctgaacacttttgtctccatctcctcatctctctc |
421523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University