View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11923_high_17 (Length: 300)
Name: NF11923_high_17
Description: NF11923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11923_high_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 9 - 285
Target Start/End: Complemental strand, 15557867 - 15557591
Alignment:
| Q |
9 |
aatgagggactatgcttgtagcctgctgcagtgtgggaaccataatatccttgtccaacaacaccctcttgggaatagaaacatcctgctggccaatgtc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| ||||||||||||||||||||||| ||||| | |||||| |
|
|
| T |
15557867 |
aatgagggactatgcttgtagcctgctgctctgtgggaaccgtaatatccttgtccaacaataccctcttgggaatagaaacatcttgctgactaatgtc |
15557768 |
T |
|
| Q |
109 |
cacagaggcaaatgcctttgaagatccaatgccctctggattatccttagacttccacgtttgttttgatctttgcgaatgaaccggttgcttcccgtta |
208 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15557767 |
cacagaggcaaaggcctttgaagatccaatgccctccagattatccttagacttccacgtttgttttgatctttatgaatgaaccggttgcttcccgtta |
15557668 |
T |
|
| Q |
209 |
tcaatagttttctttccaacgtctgtagggtgctcatgtgtttccgctctttgagggcgtaggcgacggcattaatt |
285 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |||| |||| |
|
|
| T |
15557667 |
tcaatagttttctttccaacgtctgtatggtgctcatgtgtttccgctctttgagggtgtaggcgacagcatgaatt |
15557591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 116 - 259
Target Start/End: Complemental strand, 24026496 - 24026353
Alignment:
| Q |
116 |
gcaaatgcctttgaagatccaatgccctctggattatccttagacttccacgtttgttttgatctttgcgaatgaaccggttgcttcccgttatcaatag |
215 |
Q |
| |
|
||||| |||||||| || | ||||||||| ||||||||||| | ||||| | |||||||| | ||||||||||||||||||||| ||||||||||| | |
|
|
| T |
24026496 |
gcaaacgcctttgaggacctaatgccctccggattatccttcggtttccaggcttgttttggttgttgcgaatgaaccggttgcttaccgttatcaattg |
24026397 |
T |
|
| Q |
216 |
ttttctttccaacgtctgtagggtgctcatgtgtttccgctctt |
259 |
Q |
| |
|
||||||||||||||| ||| || | ||||||||||||| ||||| |
|
|
| T |
24026396 |
ttttctttccaacgtttgttggctactcatgtgtttccactctt |
24026353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 116 - 156
Target Start/End: Complemental strand, 24056339 - 24056299
Alignment:
| Q |
116 |
gcaaatgcctttgaagatccaatgccctctggattatcctt |
156 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
24056339 |
gcaaacgcctttgatgatccaatgccctctggattatcctt |
24056299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 123 - 211
Target Start/End: Original strand, 22392562 - 22392650
Alignment:
| Q |
123 |
cctttgaagatccaatgccctctggattatccttagacttccacgtttgttttgatctttgcgaatgaaccggttgcttcccgttatca |
211 |
Q |
| |
|
||||||| || ||||| ||||| || |||||||| | |||||| |||||||||||| |||| ||||| || || ||||| || |||||| |
|
|
| T |
22392562 |
cctttgaggagccaattccctccgggttatccttcggcttccaagtttgttttgatttttgtgaatggactggctgctttcctttatca |
22392650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University