View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11923_high_19 (Length: 270)
Name: NF11923_high_19
Description: NF11923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11923_high_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 49298473 - 49298231
Alignment:
| Q |
1 |
tgagctatggtatagtgatggagatatagatgtgatcatatctttctgtttagaaacttttttgttaccgatatcattgtatatgtnnnnnnnnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
49298473 |
tgagctatggtatagtgatggagatatagatgttatcatatctttctgtttagaaacttttttgttatcga-atcattgtatatggaggggggcacc--- |
49298378 |
T |
|
| Q |
101 |
nntgtcgtcaatatttgaacgagtgtaaactctaatgactattttgaccctgtgaataatgttattgaaatgactctcttaaccgcgtgaggatcatgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49298377 |
---gtcgtcaatatttgaacgagtgtaaactctaatgactattttgaccctgtgaat---gtaattgaaatgactctcttaaccgcgtgaggatcatgat |
49298284 |
T |
|
| Q |
201 |
caaaaacgaaaaaggtattaacttgatttcccgcccaaaacagggaagttttg |
253 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49298283 |
cgaaaacgaaaaaggtattaacttgatttcccgcccaaaacagggaagttttg |
49298231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University