View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11923_low_22 (Length: 254)
Name: NF11923_low_22
Description: NF11923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11923_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 15171288 - 15171452
Alignment:
| Q |
1 |
tttatatcagtagattcaaataagtcaaccgatcaggcctatgctataagatgtttttataaactatccgggagagtttatgtaaactagttgaagacaa |
100 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | || |
|
|
| T |
15171288 |
tttatatcagtagattcagataagtcgaccgatcaggcctatgctataagatgtttttataaactatctgggagagtttatgtaaactagttgaa-aaaa |
15171386 |
T |
 |
| Q |
101 |
cttatgtatatgttacaaattgtttccataaactctctgaaaga-tctcgtaaatgtttatgctag |
165 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||| ||||| ||||||||||||||| |
|
|
| T |
15171387 |
cttatgtatatgttataaattgtttccataaactctttgaaagagtctcgcaaatgtttatgctag |
15171452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 203 - 243
Target Start/End: Original strand, 15171452 - 15171492
Alignment:
| Q |
203 |
gcatttatgagagacttatagtaattcttgtgtgtttgttg |
243 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
15171452 |
gcatttatgagagacttgcattaattcttgtgtgtttgttg |
15171492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University