View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11924_high_4 (Length: 270)
Name: NF11924_high_4
Description: NF11924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11924_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 7 - 265
Target Start/End: Complemental strand, 46357642 - 46357384
Alignment:
| Q |
7 |
tcaacattgtgttcatcccaattctttcttgccgtcttggccgacccagccaacatatcagaaatcttagaaatccctgctaccatcttcttcttcgcag |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
46357642 |
tcaacattgtgttcatcccaattctttcttgttgtcttggccgacccagccaacatatcagaaatcttagaaatcccagctaccatcttcttctttgcag |
46357543 |
T |
 |
| Q |
107 |
tggaatctccaacagccggcgaaaatttgattcccccagacaaccttctcccaggagaaattgaagctcttctaggattgggcgaaggctgcttccttgc |
206 |
Q |
| |
|
||||||||||||| || |||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46357542 |
tggaatctccaaccgctggcgaaaacttgattcccccggacaaccttctccccggagaaattgaagctcttctaggattcggcgaaggctgcttccttgc |
46357443 |
T |
 |
| Q |
207 |
tgtcggagaaggctgtctatacctggagggaacaataatcgccgcctcccgtgaaacct |
265 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
46357442 |
cgtcggagagggctgtctatacctggagggaacaataatggccgcctcacgtgaaacct |
46357384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University