View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11924_low_2 (Length: 411)
Name: NF11924_low_2
Description: NF11924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11924_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 45 - 397
Target Start/End: Complemental strand, 54014027 - 54013680
Alignment:
| Q |
45 |
acatctaattttgatggcagtgattggaatacctatctttggggcttcaatgatgggatatggatccggaagtttggtatacggctatgttttgattttt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54014027 |
acatctaattttgatggcagtgattggaatacctatctttggggcttcaatgatgggatatggatccggaagtttggtatacggctatgttttgattttt |
54013928 |
T |
|
| Q |
145 |
gattttctaagatgcttgggtcattgcaacgttgaaataatcccacacaaattgttcaaggcatttccatttcttagatatgtgatatacacaccaacgt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
54013927 |
gattttctaagatgcttgggtcattgcaacgttgaaataatcccacacaaattgttcaaggcatttccatttcttagatatgtgatacacacaccaacgt |
54013828 |
T |
|
| Q |
245 |
aagtttattaaaatttacatttacatttgtccaaaatttagattacagttaatgcacccttgaggttgagtaacaaaacaaagtacgaatctctcttact |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54013827 |
aagtttattaaaatttacatttacatttgtccaaaatttagattacagttaatgcacccttgaggttgagtaa-----caaagtacgaatctctcttact |
54013733 |
T |
|
| Q |
345 |
tacactcattacttgttcaattgtcagacacataaaatagccccctcattcat |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54013732 |
tacactcattacttgttcaattgtcagacacataaaatagccccctcattcat |
54013680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University