View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11925_high_5 (Length: 247)
Name: NF11925_high_5
Description: NF11925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11925_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 37136182 - 37136411
Alignment:
| Q |
1 |
aatgaaagtgacacgtagtatcatgataatgaaaccagctgggtatcagattaatggatcagcccctgcttctcccgccggttctactcctccggtgtct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37136182 |
aatgaaagtgacacgtagtatcatgataatgaaaccagctgggtatcagagtaatggatcagcacctgcttctcccgccggttctactcctccggtgtct |
37136281 |
T |
 |
| Q |
101 |
ccgttttccggtaaggtactttcaataataaaatgtctaattagaccttggctttctgggagctgtgtgtgtggactgtggagtgcctttgagtgagtga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||| |||||||||||| |
|
|
| T |
37136282 |
ccgttttccggtaaggtactttcaataataaaatgtctaattagaccttggctttctgggagc----tatgtggagtgtg------tcttgagtgagtga |
37136371 |
T |
 |
| Q |
201 |
gagaagctcaactttgtatggaggggtaattctgtccttt |
240 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37136372 |
gagaagctcaactttgtatagaggggtaattctgtccttt |
37136411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 68 - 117
Target Start/End: Original strand, 46440765 - 46440814
Alignment:
| Q |
68 |
gcttctcccgccggttctactcctccggtgtctccgttttccggtaaggt |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46440765 |
gcttctcccgccggttctaccactccggtgtctccgttttccggtaaggt |
46440814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University