View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11925_high_7 (Length: 240)
Name: NF11925_high_7
Description: NF11925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11925_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 225
Target Start/End: Original strand, 18100134 - 18100340
Alignment:
| Q |
19 |
aaatagttaatgaagaactgtggaaagaagcacaaacgtatggagacatacagttgatgccgtttgttgactactacagcctcatcacctggaaatcttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18100134 |
aaatagttaatgaagaactgtggaaagaagcacaaacgtatggagacatacagttgatgccgtttgttgactactacagcctcatcacctggaaatcttt |
18100233 |
T |
 |
| Q |
119 |
agcaatatgtattttcggggtaatgtccgttgtcttgtattttctttgacttggcaggaaaatctttcctcttctcattggcaatatcttttgaacagac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18100234 |
agcaatatgtattttcggggtaatgtccgttgtcttgtattttctttgacttggcaggaaaatctttcctcttctcattggcaatatcttttgaacagac |
18100333 |
T |
 |
| Q |
219 |
acaggtt |
225 |
Q |
| |
|
||||||| |
|
|
| T |
18100334 |
acaggtt |
18100340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University