View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11925_high_8 (Length: 240)
Name: NF11925_high_8
Description: NF11925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11925_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 33223716 - 33223506
Alignment:
| Q |
18 |
acctataacatttgaactataggtatcaacattaagaacttcacatggttcacgaccagatatctctttagccttcatctgataatactctttaaatgca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33223716 |
acctataacatttgaactataggtatcaacattaagaacttcacatggttcacgaccagatatctctttagccttcatctgataatactctttaaatgca |
33223617 |
T |
 |
| Q |
118 |
atatcaaacccttctttctccaacactttgtctttccaattctgaaactcaaccaaagtttgataagccggctcgccgtgaccaagaagtttaatgctat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33223616 |
atatcaaacccttctttctccaacactttgtctttccaattctgaaactcaaccaaagtttgataagccggctcgccgtgaccaagaagtttaatgctat |
33223517 |
T |
 |
| Q |
218 |
atcctttgctt |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
33223516 |
gtcctttgctt |
33223506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University