View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11925_low_11 (Length: 221)
Name: NF11925_low_11
Description: NF11925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11925_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 10 - 205
Target Start/End: Original strand, 38182547 - 38182748
Alignment:
| Q |
10 |
agcagagacacaaaatgatatgagaaaaagcttttaagaactctccttttggtacatgaattgcagtcaaaattgagcattgattagcactggcaacctc |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38182547 |
agcagaaacacaaaatgatatgagaaaaagcttttaagaactctccttttggtacatgaattgcagtcaaaattgagcattgattagcactggcaacctc |
38182646 |
T |
|
| Q |
110 |
gagtttctcaactgacagacaaaaggggcttcaacatacttatat------aacaatgaagcaaaaaccggtcactccttgaagtgttaagagtgtgcaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38182647 |
aagtttctcaactgacagacaaaaggggcttcaacatacttatatgcttgcaacaatgaagcaaaaaccggtcactccttgaagtgttaagagtgtgaaa |
38182746 |
T |
|
| Q |
204 |
ct |
205 |
Q |
| |
|
|| |
|
|
| T |
38182747 |
ct |
38182748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University