View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11926_high_17 (Length: 241)
Name: NF11926_high_17
Description: NF11926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11926_high_17 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 7185036 - 7184813
Alignment:
| Q |
18 |
acccaggacagcatatcagcaccttatctctagtgtttggataatcggaatcattaactctcagaaactgtgttgatcagtgtgtataatgaacttacaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
7185036 |
acccaggacagcatatcagcaccttatctctagtgtttggataatcggaatcattaactctcagaaactgtgttgatcagtttgtataatgaacttacga |
7184937 |
T |
 |
| Q |
118 |
attagtaagtaggttcaccatttcttcacttccaaggtgatggcgaacaagtctctaacaaaacatggcgcaacacctctttgatgttaggcaaaacctg |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7184936 |
attagtaagcaggttcaccatttcttcacttccaaggtgatggcgaacaagtctctaacaaaacatggcgcaacacctctttgatgttaggcaaaacctg |
7184837 |
T |
 |
| Q |
218 |
actaggggccacaatcttggcctt |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7184836 |
actaggggccacaatcttggcctt |
7184813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University