View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11926_high_18 (Length: 241)
Name: NF11926_high_18
Description: NF11926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11926_high_18 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 29607788 - 29607565
Alignment:
| Q |
18 |
ttaagcaatttgggcgttcatgatctcatatttaagtttgcatttcttgataactcaaaatctcatatcactattattgcttgagcaaagaccacaatac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607788 |
ttaagcaatttgggcgttcatgatctcatatttaactttgcatttcttgataactcaaaatctcatatcactattattgcttgagcaaagaccacaatac |
29607689 |
T |
|
| Q |
118 |
aatgaaagaacaaaaggataagaaaaatattatgagtataattgttcatcattcaattccatacatatgaaataattttatatttttgcaaaccaaataa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607688 |
aatgaaagaacaaaaggataagaaaaatattatgagtataattgttcatcattcaattccatacatatgaaataattttatatttttgcaaaccaaataa |
29607589 |
T |
|
| Q |
218 |
ccgtttcgctcgaatccatgtttt |
241 |
Q |
| |
|
|||||||||| ||||||||||||| |
|
|
| T |
29607588 |
ccgtttcgcttgaatccatgtttt |
29607565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University