View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11926_low_15 (Length: 261)
Name: NF11926_low_15
Description: NF11926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11926_low_15 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 12 - 261
Target Start/End: Original strand, 29607089 - 29607338
Alignment:
| Q |
12 |
gagaagaaaacacaagcatagtaagcataagaaacatcacgcactagctctagcaccagagcctacaagttcaagttcaacaatcattaggaggagtccc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607089 |
gagaagaaaacacaagcatagtaagcataagaaacatcacgcactagctctagcaccagagcctacaagttcaagttcaacaatcattaggaggagtccc |
29607188 |
T |
 |
| Q |
112 |
ccagcaccactggctgatgataatactacaatgagttcagatgaaggaccgtcaccagcacccagtcccagtgcggtaatatccttttccattttacttt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29607189 |
ccagcaccactggctgatgataatactacaatgagttcagatgaaggaccgtcaccagcacccagtcccagtgcggtaatatctttttccattttacttt |
29607288 |
T |
 |
| Q |
212 |
aagttacaattctatatttacggacctctttggtctggattatgccgcat |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29607289 |
aagttacaattctatatttacggacctctttggtctggatcatgccgcat |
29607338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University