View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11926_low_21 (Length: 203)
Name: NF11926_low_21
Description: NF11926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11926_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 37987063 - 37986938
Alignment:
| Q |
1 |
tgttctaaaagaatataaaagagagagagatctcaactacccaagcataaaatgaggcattgccttgtattatatacagaaatagaaatgatacagctaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37987063 |
tgttctaaaagaatataaaagagagagagatctcaactactcaagcataaaatgaggcattgccttgtattatatacagaaatagaaatgatacagctaa |
37986964 |
T |
 |
| Q |
101 |
ttttttaatcttaacctttagataag |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
37986963 |
ttttttaatcttaacctttagataag |
37986938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 203
Target Start/End: Complemental strand, 37986907 - 37986857
Alignment:
| Q |
153 |
aacctatgaaacatgaatactcttcgaattaggtgtgtttcggtgtcagac |
203 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||| ||||||||| |
|
|
| T |
37986907 |
aacctatgaaacatgaatactcttcggattaggtttgtttccgtgtcagac |
37986857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University