View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11926_low_21 (Length: 203)

Name: NF11926_low_21
Description: NF11926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11926_low_21
NF11926_low_21
[»] chr2 (2 HSPs)
chr2 (1-126)||(37986938-37987063)
chr2 (153-203)||(37986857-37986907)


Alignment Details
Target: chr2 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 37987063 - 37986938
Alignment:
1 tgttctaaaagaatataaaagagagagagatctcaactacccaagcataaaatgaggcattgccttgtattatatacagaaatagaaatgatacagctaa 100  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37987063 tgttctaaaagaatataaaagagagagagatctcaactactcaagcataaaatgaggcattgccttgtattatatacagaaatagaaatgatacagctaa 37986964  T
101 ttttttaatcttaacctttagataag 126  Q
    ||||||||||||||||||||||||||    
37986963 ttttttaatcttaacctttagataag 37986938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 203
Target Start/End: Complemental strand, 37986907 - 37986857
Alignment:
153 aacctatgaaacatgaatactcttcgaattaggtgtgtttcggtgtcagac 203  Q
    |||||||||||||||||||||||||| ||||||| |||||| |||||||||    
37986907 aacctatgaaacatgaatactcttcggattaggtttgtttccgtgtcagac 37986857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University