View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11927_high_11 (Length: 391)
Name: NF11927_high_11
Description: NF11927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11927_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 18 - 335
Target Start/End: Original strand, 44973810 - 44974128
Alignment:
| Q |
18 |
ctactcctaactcttcatctatttcatctgcttctagtgaagcaatcaatgatgaacacaataaaactgttgaccaaactaataatcaactcaacaaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44973810 |
ctactcctaactcttcatctatttcatctgcttctagtgaagcaatcaatgatgaacacaataaaactgttgaccaaactaataatcaactcaacaaaca |
44973909 |
T |
|
| Q |
118 |
gtgagtttcattttcttcttctatttttatcttctaggtgcttaaagannnnnnnatggaagggcaaagatggga-nnnnnnngggtgaaacnnnnnnnn |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
44973910 |
gtgagtttcattttcttcttctatttttatcttctaggtgcttaaagatttttttatggaagggcaaagatgggattttttttgggtgaaacaaaaaaaa |
44974009 |
T |
|
| Q |
217 |
gttttggaatttgattatgagcttagtttttcacctacctaattttgtttaaaaagttttagttttgatttcatgaattatgaatgtcttcattatttgt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44974010 |
gttttggaatttgattatgagcttagtttttcacctacctaattttgtttaaaaagttttagttttgatttcatgaattatgaatgtcttcattatttgt |
44974109 |
T |
|
| Q |
317 |
ggttctattctactaatat |
335 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
44974110 |
ggttctattctattaatat |
44974128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University