View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11927_high_15 (Length: 256)
Name: NF11927_high_15
Description: NF11927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11927_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 8 - 238
Target Start/End: Original strand, 49828629 - 49828859
Alignment:
| Q |
8 |
gaggaggagcacagagaaatgtcgacggcgtcttcctgtcagaaactctttgatttaggcacaaagatcatcggcgtcggtagaaactacgccgctcacg |
107 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49828629 |
gaggaagagtacagagaaatgtcgacggcgtcttcctgtcagaaactctttgatttaggcacaaagatcatcggcgtcggtagaaactacgccgctcacg |
49828728 |
T |
|
| Q |
108 |
ctaaagaactaggcaacgccgttcccaaggtcacacacactcttcttccaaatccaaatcaattcaattcacttcctcctaaaatttcataatctgatcc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49828729 |
ctaaagaactaggcaacgccgttcccaaggtcacacacactcttcttccaaatccaaatcaattcaattcacttcttcctaaaatttcataatctgatcc |
49828828 |
T |
|
| Q |
208 |
gtgtagtgtaattgattcactaattttcagg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
49828829 |
gtgtagtgtaattgattcactaattttcagg |
49828859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University