View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11927_high_22 (Length: 209)
Name: NF11927_high_22
Description: NF11927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11927_high_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 9 - 192
Target Start/End: Complemental strand, 48882707 - 48882524
Alignment:
| Q |
9 |
gaagcagagagaatggcatcaacaaacaacggtcttgttgtccgttccaaatatgcacttcatgaaattcggaggagattgttaggttgattgcttctag |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
48882707 |
gaagtagagagaatggcatcaacaaacaagggtcttgttgtccgttccaaatatgcacttcatgaaattcggaggagattgttaggttgattgcttccag |
48882608 |
T |
|
| Q |
109 |
cagtgtgattgcctcagcttctaatacagacaaagatgaataagagaaaagagacttacatattatgaattgcccctcagagtt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48882607 |
cagtgtgattgcctcagcttctaatacagacatagatgaataagagaaaagagacttacatattatgaattgcccctcagagtt |
48882524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University