View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11927_low_10 (Length: 409)
Name: NF11927_low_10
Description: NF11927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11927_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 370; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 370; E-Value: 0
Query Start/End: Original strand, 1 - 392
Target Start/End: Complemental strand, 939099 - 938711
Alignment:
| Q |
1 |
gagcttcttgatgccattgcatcacttgatcgaggagctgatgctactcctgaagaccaacaaagtgttgatcaggttgccttaaaaacctttgatttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
939099 |
gagcttcttgatgccattgcatcacttgatcgaggagctgatgctactcctgaagaccaacaaagtgttgatcaggttgccttaaaaacctttgatt--- |
939003 |
T |
|
| Q |
101 |
gcaacatttcaatatcataagttctcatgcatgcatgttttattgttgattcatggagttcattaatttctaaatagattgcacgccaacttgaagcagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
939002 |
gcaacatttcaatatcataagttctcatgcatgcatgttttattgttgattcatggagttcattaatttctaaatagattgcacgccaacttgaagcagt |
938903 |
T |
|
| Q |
201 |
taatccaacaaagcagcctcttaagtctagtttacttgatggcaaatgggagcttatatacactacctctcagtcaatcttgcaaactaaggtattattc |
300 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
938902 |
taatccaacaaagcagcctctcaagtctagtttacttgatggcaaatgggagcttatatacactacctctcagtcaatcttgcaaactaaggtattattc |
938803 |
T |
|
| Q |
301 |
catttctttttccttaccatatgtagccatgtttggataaactacttaattaaggcctgtttggactttggattggcttatttggattgcca |
392 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
938802 |
catttctttttccttgccatatgtagccatgtttggataaactacttaattaaggcctgtttggactttggattggcttatttggattgcca |
938711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 330 - 365
Target Start/End: Original strand, 17822756 - 17822791
Alignment:
| Q |
330 |
tgtttggataaactacttaattaaggcctgtttgga |
365 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17822756 |
tgtttggataaacaacttaattaaggcctgtttgga |
17822791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University