View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11927_low_14 (Length: 365)
Name: NF11927_low_14
Description: NF11927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11927_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 19 - 350
Target Start/End: Original strand, 51666334 - 51666661
Alignment:
| Q |
19 |
gatgtacagatcaataataagaatattaagaagttgaaattccctaagtttggttgtttcagaatccaacatgatgctacaggggatggttttgatattg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51666334 |
gatgtacagatcaataataagaatattaagaagttgaaattccctaagtttggttgtttcagaatccaacatgatgctacaggggatggttttgatattg |
51666433 |
T |
|
| Q |
119 |
aaattgtcgatgcttctggtcatcgttctaaccctactcacttgatcattatggttaatggtctcattggcaggtttggtttgttgatccaatatgattt |
218 |
Q |
| |
|
|| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51666434 |
aagttgttgatgcttctggtcatcgttctaaccctactcacttgatcattatggttaatggtctcattggcaggtttggtttgttgatccaatatgattt |
51666533 |
T |
|
| Q |
219 |
ttaatactttttatcaatattttaatagtaacttagctattaacaatgccnnnnnnnnnnnnnattgttttgcagtgctcataattggaaatatgctgca |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51666534 |
ttaatactttttatcaatattttaatagtaacttagctattaacaatgcc----tttttttttattgttttgcagtgctcataattggaaatatgctgca |
51666629 |
T |
|
| Q |
319 |
aagcagtttctcaaaaggtacccctatgatgt |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
51666630 |
aagcagtttctcaaaaggtacccctatgatgt |
51666661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University