View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_high_100 (Length: 240)
Name: NF11928_high_100
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_high_100 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 63 - 220
Target Start/End: Complemental strand, 13404751 - 13404594
Alignment:
| Q |
63 |
cgaatgcgattaagaaatgagaaaatataaacatacttccattttgaccagtgatgagattaacgtgactcccaaactcagtttcatgattggaatggca |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13404751 |
cgaatgcgattaagaaatgagaaaatataaacatacttccattttgaccagtgatgagattaacgtgactcccaaactcagtttcatgattggaatggca |
13404652 |
T |
|
| Q |
163 |
catgaaattctccaaccgaagcttcttgatgattcccgcttcgagactcggcgaaacc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13404651 |
catgaaattctccaaccgaagcttcttgatgattcccgcttccagactcggcgaaacc |
13404594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 95 - 222
Target Start/End: Original strand, 22523907 - 22524034
Alignment:
| Q |
95 |
atacttccattttgaccagtgatgagattaacgtgactcccaaactcagtttcatgattggaatggcacatgaaattctccaaccgaagcttcttgatga |
194 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| || || || | |||||| ||||| ||||||||||| |||||||| |||||||| || ||||||| |
|
|
| T |
22523907 |
atacttccattttggccagtgatgagattaacgttgcttccgaattgagtttcgtgattcgaatggcacataaaattctctaaccgaagttttttgatga |
22524006 |
T |
|
| Q |
195 |
ttcccgcttcgagactcggcgaaaccct |
222 |
Q |
| |
|
|||| ||||| ||| ||||||||||| |
|
|
| T |
22524007 |
ttcctgcttccagagatggcgaaaccct |
22524034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University