View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_high_109 (Length: 229)
Name: NF11928_high_109
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_high_109 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 2 - 221
Target Start/End: Complemental strand, 34584053 - 34583835
Alignment:
| Q |
2 |
atattttagttcttcaaaatataagtcttataatttttccattttcatactctttgctcttttctatcaaaatttaaacatataatcaaaattttatttt |
101 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34584053 |
atattttagttcttcgaaatataagtcttataatttttccatttttatactttttgctcgtttctatcaaaatttaaacatataatcaaaattttgtttt |
34583954 |
T |
 |
| Q |
102 |
ttagattagtttcatcttcatctctgatttctcatatgttaaacatattacttcgtaaatattcctcttaaattacatcnnnnnnntattcctcttaaat |
201 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34583953 |
ttagattagtttcatctt-atctctgatttctcatatgttaaacatactacttcataaatattcctcttaaattacatcaaaaaaatattcctcttaaat |
34583855 |
T |
 |
| Q |
202 |
gtgttttttacaaagaaaaa |
221 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
34583854 |
gtgttttttacaaagaaaaa |
34583835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University