View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_high_113 (Length: 218)
Name: NF11928_high_113
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_high_113 |
 |  |
|
| [»] scaffold0693 (2 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0693 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 65 - 218
Target Start/End: Complemental strand, 4532 - 4380
Alignment:
| Q |
65 |
atttaaaagaacttccctagatctgtctcttaaccatactaagataatgagtaaacaatttgacccactcttttggtaaatatgctttcatgctttgact |
164 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4532 |
atttaaaagaacttccctagatctatctcttaaccatactaagataatgagtaa-caatttgacccactcttttgctaaatatgctttcatgctttgact |
4434 |
T |
 |
| Q |
165 |
catgtagaaggggtgtcgttagaagatcaatcacttttctgacttttttatttc |
218 |
Q |
| |
|
||| ||||||||||||||||||||||| ||| |||||||||||| |||||||| |
|
|
| T |
4433 |
catctagaaggggtgtcgttagaagatgtatcccttttctgacttatttatttc |
4380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 4903 - 4843
Alignment:
| Q |
1 |
aagagagtgaatagcctgatttgcttgtctctatgcgaacttacccattaattaagttatt |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||| |
|
|
| T |
4903 |
aagagagtgaatagcctgatttgcttgtctctttgggaacttacccattaataaagttatt |
4843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University