View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11928_high_114 (Length: 215)

Name: NF11928_high_114
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11928_high_114
NF11928_high_114
[»] chr2 (1 HSPs)
chr2 (19-201)||(37397572-37397754)


Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 201
Target Start/End: Original strand, 37397572 - 37397754
Alignment:
19 cattatccatgagatattgcaaggcatgcaatgaaattgttgcttgctccaagatcaaacaaggctttggcaaacatgaccccgctgataataatcggta 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
37397572 cattatccatgagatattgcaaggcatgcaatgaaattgttgcttgctccaagatcaaacaaggctttggcaaacatgaccccgctgataacaatcggta 37397671  T
119 atgtaacccttcatggatccctacactttgatgattatcacggtatgcagtgtttccaaggtactctcgactgcttttcatct 201  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37397672 atgtaacccttcatggatccctacacttcgatgattatcacggtatgcagtgtttccaaggtactctcgactgcttttcatct 37397754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University