View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_high_114 (Length: 215)
Name: NF11928_high_114
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_high_114 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 201
Target Start/End: Original strand, 37397572 - 37397754
Alignment:
| Q |
19 |
cattatccatgagatattgcaaggcatgcaatgaaattgttgcttgctccaagatcaaacaaggctttggcaaacatgaccccgctgataataatcggta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37397572 |
cattatccatgagatattgcaaggcatgcaatgaaattgttgcttgctccaagatcaaacaaggctttggcaaacatgaccccgctgataacaatcggta |
37397671 |
T |
 |
| Q |
119 |
atgtaacccttcatggatccctacactttgatgattatcacggtatgcagtgtttccaaggtactctcgactgcttttcatct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37397672 |
atgtaacccttcatggatccctacacttcgatgattatcacggtatgcagtgtttccaaggtactctcgactgcttttcatct |
37397754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University