View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_high_115 (Length: 214)
Name: NF11928_high_115
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_high_115 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 20 - 198
Target Start/End: Complemental strand, 28669080 - 28668902
Alignment:
| Q |
20 |
gcacatgtttggtgaagtggcaacgtctcaatacaattactacttctgtgtaagatcagtgtttagtgtcaacacatgtaggactattagtgtgtgcaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28669080 |
gcacatgtttggtgaagtggcaacgtctcaatacaattactacttctgtgtaagatcagtgtttagtgtcaacacatgtaggactattagtgtgtgcaga |
28668981 |
T |
 |
| Q |
120 |
gtaaacactacaccttgtccatgtcatgacagatttcaattatttatacacacatggacttgtcccaaccacatttcat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28668980 |
gtaaacactacaccttgtccatgtcatgacagatttcaattatttatacacacatggacttgtcccaaccacatttcat |
28668902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University