View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_high_116 (Length: 211)
Name: NF11928_high_116
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_high_116 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 19 - 202
Target Start/End: Original strand, 41224694 - 41224877
Alignment:
| Q |
19 |
tctaaatcccttttttctgttagttaacatttaacaaagctttagcaactagaagaattcaagttgaagtttcctactttaatttcaaatttgatggctt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41224694 |
tctaaatcccttttttctgttagttaacatttaacaaagctttagcaactagaggaattcaagttgaagtttcctactttaatttcaaatttgatggctt |
41224793 |
T |
|
| Q |
119 |
gtgttgtgctgcnnnnnnnaatcttcttcatttctttttatggttttcacacactgaaatttctgtctattttagatctctgct |
202 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41224794 |
gtgttgtgctgctttttttaatcttcttcatttctttttatggtgttcacacactgaaatttctgtctattttagatctgtgct |
41224877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University